• Ешқандай Нәтиже Табылған Жоқ

Microbiological and molecular genetic characteristics of plant pathogenic fungi, infects soybean in Almaty region    129-136

N/A
N/A
Protected

Academic year: 2022

Share "Microbiological and molecular genetic characteristics of plant pathogenic fungi, infects soybean in Almaty region    129-136"

Copied!
13
0
0

Толық мәтін

(1)

ISSN 2224-5308

ҚАЗАҚСТАН РЕСПУБЛИКАСЫ ҰЛТТЫҚ ҒЫЛЫМ АКАДЕМИЯСЫНЫҢ

Х А Б А Р Л А Р Ы

ИЗВЕСТИЯ

НАЦИОНАЛЬНОЙ АКАДЕМИИ НАУК РЕСПУБЛИКИ КАЗАХСТАН

N E W S

OF THE NATIONAL ACADEMY OF SCIENCES OF THE REPUBLIC OF KAZAKHSTAN

БИОЛОГИЯ ЖƏНЕ МЕДИЦИНА СЕРИЯСЫ

СЕРИЯ

БИОЛОГИЧЕСКАЯ И МЕДИЦИНСКАЯ

SERIES

OF BIOLOGICAL AND MEDICAL

4 (310)

ШІЛДЕ – ТАМЫЗ 2015 ж.

ИЮЛЬ – АВГУСТ 2015 г.

JULY – AUGUST 2015

1963 ЖЫЛДЫҢ ҚАҢТАР АЙЫНАН ШЫҒА БАСТАҒАН ИЗДАЕТСЯ С ЯНВАРЯ 1963 ГОДА

PUBLISHED SINCE JANUARY 1963 ЖЫЛЫНА 6 РЕТ ШЫҒАДЫ

ВЫХОДИТ 6 РАЗ В ГОД PUBLISHED 6 TIMES A YEAR

АЛМАТЫ, ҚР ҰҒА АЛМАТЫ, НАН РК

ALMATY, NAS RK  

(2)

Б а с

р е д а к т о р ҚР ҰҒА академигі   Ж. А. Арзықұлов

Р е д а к ц и я

а л қ а с ы:

биол. ғ. докторы, проф., ҚР ҰҒА академигі Айтхожина Н.А.; биол. ғ. докторы, проф., ҚР ҰҒА академигі Байтулин И.О. (бас редактордың орынбасары); биол. ғ. докторы, проф., ҚР ҰҒА академигі Берсімбаев Р.И.; биол. ғ. докторы, проф., ҚР ҰҒА академигі Бишімбаева Н.К.; мед. ғ.

докторы, проф., ҚР ҰҒА академигі Күзденбаева Р.С.; мед. ғ. докторы, проф., ҚР ҰҒА академигі Рахышев А.Р.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Ақшолақов С.К.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Алшынбаев М.К.; биол. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Березин В.Э.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Ботабекова Т.К.; биол. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Жамбакин К.Ж.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Қайдарова Д.Р.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Локшин В.Н.; биол. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Огарь Н.П.; мед. ғ. докторы, проф., ҚР ҰҒА корр. мүшесі Рахыпбеков Т.К.

Р е д а к ц и я

к е ң е с і:

Абжанов Архат (Бостон, АҚШ); Абелев С.К. (Мəскеу, Ресей); Лось Д.А. (Мəскеу, Ресей);

Бруно Луненфелд (Израиль); доктор, проф. Харун Парлар (Мюнхен, Германия); философии докторы, проф. Стефано Перни (Кардиф, Ұлыбритания); Саул Пуртон (Лондон, Ұлыбритания);

Сапарбаев Мурат (Париж, Франция); Сарбассов Дос (Хьюстон, АҚШ); доктор, проф. Гао Энджун (Шэньян, ҚХР)

(3)

Г л а в н ы й

р е д а к т о р академик НАН РК Ж. А. Арзыкулов

Р е д а к ц и о н н а я

к о л л е г и я:

доктор биол. наук, проф., академик НАН РК Н.А. Айтхожина; доктор биол. наук, проф., академик НАН РК И.О. Байтулин (заместитель главного редактора); доктор биол. наук, проф., академик НАН РК Р.И. Берсимбаев; доктор биол. наук, проф., академик НАН РК Н.К. Бишимбаева; доктор мед. наук, проф., академик НАН РК Р.С. Кузденбаева, доктор мед. наук, проф., академик НАН РК А.Р. Рахишев, доктор мед. наук, проф., чл.-корр. НАН РК С.К. Акшулаков, доктор мед. наук, проф., чл.-корр. НАН РК М.К. Алчинбаев; доктор биол. наук, проф., чл.-корр. НАН РК В.Э. Березин;

доктор мед. наук, проф., чл.-корр. НАН РК Т.К. Ботабекова; доктор биол. наук, проф., чл.-корр.

НАН РК К.Ж. Жамбакин; доктор мед. наук, проф., чл.-корр. НАН РК Д.Р. Кайдарова; доктор мед. наук, проф., чл.-корр. НАН РК В.Н. Локшин; доктор биол. наук, проф., чл.-корр. НАН РК Н.П. Огарь; доктор мед. наук, проф., чл.-корр. НАН РК Т.К. Рахыпбеков

Р е д а к ц и о н н ы й

с о в е т:

Абжанов Архат (Бостон, США); С.К. Абелев (Москва, Россия); Д.А. Лось (Москва, Россия);

Бруно Луненфельд (Израиль); доктор, проф. Харун Парлар (Мюнхен, Германия); доктор философии, проф. Стефано Перни (Кардиф, Великобритания); Саул Пуртон (Лондон, Великобритания); Сапарбаев Мурат (Париж, Франция); Сарбассов Дос (Хьюстон, США); доктор, проф. Гао Энджун (Шэньян, КНР)

«Известия НАН РК. Серия биологическая и медицинская». ISSN 2224-5308 Собственник: РОО «Национальная академия наук Республики Казахстан» (г. Алматы)

Свидетельство о постановке на учет периодического печатного издания в Комитете информации и архивов Министерства культуры и информации Республики Казахстан №5546-Ж, выданное 01.06.2006 г.

Периодичность: 6 раз в год Тираж: 300 экземпляров

Адрес редакции: 050010, г. Алматы, ул. Шевченко, 28, ком. 219, 220, тел. 272-13-19, 272-13-18, www:nauka-nanrk.kz / biological-medical.kz

© Национальная академия наук Республики Казахстан, 2015 Адрес типографии: ИП «Аруна», г. Алматы, ул. Муратбаева, 75

(4)

E d i t o r

i n

c h i e f Zh.A. Arzykulov, academician of NAS RK

E d i t o r i a l

b o a r d:

N.A. Aitkhozhina, dr. biol. sc., prof., academician of NAS RK; I.O. Baitulin, dr. biol. sc., prof.,

academician of NAS RK (deputy editor); R.I. Bersimbayev, dr. biol. sc., prof., academician of NAS RK;

N.K. Bishimbayeva, dr. biol. sc., prof., academician of NAS RK; R.S. Kuzdenbayeva, dr. med. sc., prof., academician of NAS RK; A.R. Rakhishev, dr. med. sc., prof., academician of NAS RK; S.K. Akshulakov, dr. med. sc., prof., corr. member of NAS RK; M.K. Alchinbayev, dr. med. sc., prof., corr. member of NAS RK; V.E. Berezin, dr. biol. sc., prof., corr. member of NAS RK; T.K. Botabekova, dr. med. sc.,

prof., corr. member of NAS RK; K.Zh. Zhambakin, dr. biol. sc., prof., corr. member of NAS RK;

D.R. Kaidarova, dr. med. sc., prof., corr. member of NAS RK; V.N. Lokshin, dr. med. sc., prof., corr.

member of NAS RK; N.P. Ogar, dr. biol. sc., prof., corr. member of NAS RK; T.K. Rakhypbekov, dr. med. sc., prof., corr. member of NAS RK

E d i t o r i a l

s t a f f:

Abzhanov Arkhat (Boston, USA); S.K. Abelev (Moscow, Russia); D.A. Los (Moscow, Russia); Bruno Lunenfeld (Israel); Harun Parlar, dr., prof. (Munich, Germany); Stefano Perni, dr. phylos., prof.

(Cardiff, UK); Saparbayev Murat (Paris, France); Saul Purton (London, UK); Sarbassov Dos (Houston, USA); Gao Endzhun, dr., prof. (Shenyang, China)

News of the National Academy of Sciences of the Republic of Kazakhstan. Series of biology and medicine.

ISSN 2224-5308

Owner: RPA "National Academy of Sciences of the Republic of Kazakhstan" (Almaty)

The certificate of registration of a periodic printed publication in the Committee of information and archives of the Ministry of culture and information of the Republic of Kazakhstan N 5546-Ж, issued 01.06.2006

Periodicity: 6 times a year Circulation: 300 copies

Editorial address: 28, Shevchenko str., of. 219, 220, Almaty, 050010, tel. 272-13-19, 272-13-18, http://nauka-nanrk.kz / biological-medical.kz

© National Academy of Sciences of the Republic of Kazakhstan, 2015 Address of printing house: ST "Aruna", 75, Muratbayev str, Almaty

(5)

N E W S

OF THE NATIONAL ACADEMY OF SCIENCES OF THE REPUBLIC OF KAZAKHSTAN SERIES OF BIOLOGICAL AND MEDICAL

ISSN 2224-5308

Volume 4, Number 310 (2015), 129 – 136

MICROBIOLOGICAL AND MOLECULAR GENETIC CHARACTERISTICS

OF PLANT PATHOGENIC FUNGI, INFECTS SOYBEAN IN ALMATY REGION

А. I. Seitbattalova, S. Т. Daugalieva, О. N. Shemshura, E. Т. Ismailova Institute of Microbiology and Virology, Committee of Science,

Ministry of Science and Education, Almaty, Kazakhstan.

E-mail: aika2006_81@mail.ru

Keywords: phytopathogenic fungi, Fusarium, Alternaria, morphological and microscopic characteristics ITS- DNA regions, primers, sequencing.

Abstract. As a result of studies on the morphological characteristics of plant pathogenic fungi that infect soybean in the Almaty region, allowed to determine their tribal affiliation.

The total cellular DNA from Fusarium and Alternaria fungi has been isolated by the CTAB method. The PCR has been carried out with ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3'), and ITS4(5'-TCCTCCGCTTATTGATATGC- 3') primers. Bioinformaticdata analysis and homology search of the nucleotide sequences have been performed using available genetic database of GenBank (http://www.ncbi.nlm.nih.gov).

We have found that the CTAB method is optimal to use for genomic DNA extraction from a purifiedfungi culture. Sequencing of the fungal DNA allowed identifying species of Fusarium and Alternaria. Determined nucleotide sequences of isolated fungi completely matched with sequences of similar fungal region available in GenBank database. According to the phylogenetic analysis based on the comparison of DNA sequences of ITS region, the strain of Fusarium sp.has been grouped in a separate cluster composed of similar strains of F. incar-

natum, F. equiseti, F. chlamidosporum, and F. campoceras; whereas, the strain of Alternaria sp. is very similar to A. alternata, A. tenuissima, A. compacta, and A. porrispecies.

(6)

УДК 633.854.78:632.4

МИКРОБИОЛОГИЧЕСКАЯ И МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА ФИТОПАТОГЕННЫХ ГРИБОВ,

ПОРАЖАЮЩИХ СОЮ В АЛМАТИНСКОЙ ОБЛАСТИ

А. И. Сейтбатталова, С. Т. Даугалиева, О. Н. Шемшура, Э. Т. Исмаилова РГП «Институт микробиологии и вирусологии» КН МОН РК, Алматы, Казахстан

Ключевые слова: фитопатогенные грибы, Fusarium, Alternaria, морфолого-микроскопическая харак- теристика, ITS-регионы ДНК, праймеры, секвенирование.

Аннотация. В результате проведенных исследований морфологических особенностей фитопатогенных грибов, поражающих сою в Алматинской области, определена их родовая принадлежность.

Проведено изолирование суммарной клеточной ДНК из грибов Fusarium Alternaria при помощи СТАВ-метода. Реакция ПЦР была выполнена с праймерами ITS 5 5’ – ggaagtaaaagtcgtaacaagg-3’ и ITS 4 5’- tcctccgcttattgatatgc-3’. Биоинформационный анализ и поиск гомологических нуклеотидных после-

довательностей проведен в открытой базе генетических данных GenBank (http://www.ncbi.nlm.nih.gov).

Установлено, что использование СТАВ-метода для экстракции геномной ДНК из чистой культуры гриба является оптимальным. В результате исследований сиквенса грибоврода Fusarium и Alternaria удалось идентифицировать видовую принадлежность. Сравнение нуклеотидных последовательностей с базой данных GenBank показало 100% степень сходства районов выделенных нами грибов с имеющимися в базе данных.

Согласно филогенетическому анализу, основанному на сравнении последовательностей ДНК ITS региона, штаммы Fusariumsp. сгруппированы в отдельный кластер, который имеет большее сходство с F. incarnatum, F. equiseti, F. chlamidosporumи F. сampoceras.Штаммы Alternariasp. имеют большое сходство с А. alternata, A.

tenuissima, A. compacta, A. porri.

Введение. Фитопатогенные грибы являются многочисленной и вредоносной группой возбу- дителей болезней растений, приводящей к значительным потерям урожайности сельскохо- зяйственных культур. Для своевременного применения средств защиты растений от болезней и контроля зараженности фитопатогенными грибами необходима их детекция и точная иденти- фикация. В последние годы для идентификации фитопатогенных микроорганизмов применяется молекулярно-генетический метод. Он превосходит традиционные методы по специфичности, чувствительности, быстроте проведения анализа, производительности, и служит их существенным дополнением [1-6].

Идентификация фитопатогенных грибов необходима для изучения их таксономии и эволюции, их взаимоотношений с растениями-хозяевами, генетических основ восприимчивости и устой- чивости растений, что, в конечном счете, должно помочь в разработке способов борьбы с патогенами и в селекции растений, невосприимчивых к болезням [7-10].

В полевых условиях предварительный диагноз болезней, вызываемых фитопатогенными грибами, ставят по проявлению симптомов заболевания, а точную идентификацию возбудителя проводят в лаборатории, главным образом по морфолого-культуральным признакам патогена с применением методов микроскопии и культивирования на питательных средах. Однако, морфо- логические характеристики спор у близкородственных видов микромицетов могут совпадать, а внутри одного вида значительно варьировать. Кроме того, симптомы болезни могут проявляться нетипично или заболевание может проходить в скрытой форме [11-14].

В связи с этим, применение более чувствительных методов является актуальным и вос- требованным в диагностике фитопатогенных микроорганизмов.

Материалы и методы

Объектом исследований являлись штаммы микроскопических грибов рода Fusarium, Alternaria, выделенные из пораженных семян сои, произрастающей в Алматинской области.

Выделение и учет микромицетов осуществлялись стандартными микологическими методами [15-18]. Морфологические свойства и скорость роста грибов изучали при культивировании на

(7)

среде картофельно-глюкозный агар при температуре +24оС. Микроскопический анализ проводили с помощью оптического микроскопа с использованием цифрового изображения (IM 500 – Leica).

Для выделения геномной ДНК штаммы грибов культивировали на жидкой картофельной среде, содержащей 30 г/л сахарозы, в течение 5 суток. Затем в стерильных условиях биомассу грибов весом 100-200 мг переносили в микропробирки и помещали в криотермостат при -70°С на 15-20 минут.

Экстракцию геномной ДНК проводили с использованием СТАВ-буфера (2M Tris, 5 M NaCl, 0,5 M EDTA, 5% СТАВ). Предварительно замораживали пробы весом 100-200 мг в микропро- бирках при -70°С в течение 15 минут. Затем пробы гомогенизировали в 600 мкл STAB-буфера, предварительно нагретого до 65°, инкубацию проводили в термостате 1 час при температуре 56°С.

Затем к пробам добавляли 600 мкл хлороформ-изопропаноловой смеси и оставляли при комнатной температуре в течение 1 часа. После этого проводили центрифугирование при 3000 об/мин в течение 5 минут, супернатант без интерфазы переносили в чистые пробирки. Осаждение ДНК проводили изопропанолом при комнатной температуре в течение 10-12 часов.

После этого проводили центрифугирование при 12000 об/мин в течение 10 мин для удаления супернатанта, осадок подсушивали и растворяли его в 20 мкл воды. Электрофорез проводили в 1%

агарозном геле, в камере с ТЕ-буфером при 299 mA и 90 V в течение 15 минут, детекцию ДНК осуществляли в УФ-свете.

ПЦР проводили с использованием прямого праймера. Реакция ПЦР была выполнена с праймерами ITS 5 5’ – ggaagtaaaagtcgtaacaagg-3’ и ITS 4 5’- tcctccgcttattgatatgc-3’. Очистку ПЦР продуктов от не связавшихся праймеров проводили, ферментативным методом используя, Exonuclease I (Fermentas) и щелочную фосфатазу (Shrimp Alkaline Phosphatase, Fermentas) [19, 20].

Анализ нуклеотидной последовательности ITS-области ДНК проводили с помощью авто- матического секвенатора ABI Prism I377 (Applied Biosystems) c использованием ABI PrismBigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit согласно протоколам производителя.

Биоинформационный анализ данных и поиск гомологических нуклеотидных последовательностей проводили в открытой базе генетических данных GenBank (http://www.ncbi.nlm.nih.gov).

Для построения филогенетических деревьев использовали программное обеспечение – Mega 5.

Использовали алгоритм ClustalW для выравнивания нуклеотидных последовательностей, по- строение древ проводили с использованием метода присоединения ближайших соседей (Neiighbor- Joining NJ).

Результаты исследований и их обсуждение

На начальном этапе работы по идентификациивыделенных из пораженных семян сои в чистую культуру грибов, основаны на морфолого-культуральных признаках. Изучение морфологических свойств позволило определить родовую принадлежность фитопатогенных грибов.

Грибы рода Fusarium образовывали быстрорастущие бежевые пушистые колонии, имеющие легкий пурпурный оттенок, гифы септированные, бесцветные. При микроскопии обнаруживались многочисленные макроконидии – 3-5 клеточные, от слегка серповидно изогнутых до почти прямых, веретеновидные с закругленными кончиками.

Выделенные грибы рода Alternaria образовывали серо-оливковый воздушный мицелий, гифы септированные, светло-коричневые, конидий коричневые, разнообразные по форме – обратно- булавовидные, обратногрушевидные, муральные, с 3-8 поперечными и 1-2 продольными перегородками, спороношение обильное (рисунок 1).

Эти характерные морфологические признаки позволили идентифицировать изоляты как грибы рода Fusariumsp. и Alternariasp.

В ходе проведенной молекулярно-генетической диагностики было выявлено наличие гене- тического материала патогенов. Результаты молекулярно-генетических исследований показали, что использование СТАВ метода для экстракции геномной ДНК из чистой культуры гриба является оптимальным. Детекция результатов экстракции при помощи NanoDrop 2000с показала поло- жительный результат высокого содержания в пробе тотальной ДНК.

(8)

Рисунок 1 – Грибы рода Fusariumsp. и Alternariasp., выделенные из пораженных семян сои

Рисунок 2 – Электрофореграмма ПЦР продуктов амплификации ITS региона:

1–7 образцы, нумерация согласно п/н; (М) маркер молекулярного веса (Fermentas) (100–10000 п.н., от 100–1000 шаг 100 п.н.)

В результате проведения ПЦР, как видно из рисунка 2, во всех образцах присутствует спе- цифическая полоса, свидетельствующая об амплификации ITS региона. Следует также отметить, что расположение фракций на электрофореграмме зависело от размера выявляемого фрагмента ДНК патогена и являлось величиной видоспецифичной. Данный признак использовался в качестве первичного критерия при проведении идентификации возбудителя заболевания.

В результате исследований сиквенса грибовродов Fusarium и Alternaria подтвердилась их родовая принадлежность. Сравнение нуклеотидных последовательностей с базой данных GenBank показало 100% степень сходства районов выделенных нами грибов с имеющимися в базе данных.

Нуклеотидные последовательности были анализированы и объединены в общую последова- тельность в программном обеспечении SeqMan (DNA Star). После чего были удалены концевые фрагменты (нуклеотидные последовательности праймеров, фрагменты, имеющие низкий пока-

(9)

затель качества). Полученные последовательности были идентифицированы в GeneBank по алгоритму BLAST. Согласно филогенетическому анализу, основанному на сравнении последо- вательностей ДНК ITS региона, штаммы Fusariumsp. сгруппированы в отдельный кластер, который имеет большее сходство с F. incarnatum, F. equiseti, F. сhlamidosporum,F. avenacium, F. acuminatum, F. tricinctum, F. arthosporioides и F. torulosum(рисунок 3, 4).

Рисунок 3 – Филогенетическое дерево, построенное на основании анализа фрагмента ITS региона рода Fusarium

Рисунок 4 – Филогенетическое дерево, построенное на основании анализа фрагмента ITS региона рода Fusarium

KC215121.1 Fusarium oxysporum KC215127.1 Fusarium oxysporum

FIU34577 Fusarium inflexum 1

JX867234.1 Fusarium chlamydosporum JF817304.1 Fusarium chlamydosporum KC254029.1 Fusarium equiseti

HQ649907.1 Fusarium equiseti EF158029.1 Fusarium incarnatum JX480580.1 Fusarium incarnatum HQ625612.1 Fusarium incarnatum

EU520172.1Fusarium incarnatum

JX402189.1 Fusarium avenaceum AF111067.1 Fusarium arthrosporioides JX534349.1 Fusarium torulosum

JX534365.1 Fusarium torulosum JX534363.1 Fusarium torulosum HM068322.1 Fusarium acuminatum JX076999.1 Fusarium acuminatum KC180708.1 Fusarium tricinctum

2

KC311511.1 Fusarium avenaceum JX077013.1 Fusarium acuminatum

AF111064.1 Fusarium graminum

(10)

Рисунок 5 – Филогенетическое дерево, построенное на основании анализа фрагмента ITS региона рода Alternaria

Нуклеотидная последовательность образцов 3 и 4 (грибы рода Alternaria) расположена на одной ветви с представителями Alternariaalternata, Alternariatenuissima, Alternariaporri, Alterna- riaastragali, Alternariapalandui и др. (рисунок 5). Учитывая высокую идентичность этого рода, данная последовательность имела максимальную идентичность при использовании BLAST с несколькими видами.

DQ323699.1 Alternaria alternata EU128529.1 Alternaria compacta

KC337040.1 Alternaria tenuissima JN108904.1 Alternaria brassicae DQ242505.1 Alternaria arborescens EF110522.1 Alternaria seleniiphila EF110523.1 Alternaria astragali DQ323682.1 Alternaria palandui JF422721.1 Alternaria porri JX418345.1 Alternaria pomicola JX418349.1 Alternaria quercus KC337034.1 Alternaria tenuissima JX310562.1 Alternaria alternata JX310567.1 Alternaria alternata KC337035.1 Alternaria tenuissima EU732734.1 Alternaria tenuis JX418346.1 Alternaria populi JX418344.1 Alternaria pharbitidis DQ323680.1 Alternaria destruens JN867470.1 Alternaria triticimaculans JN867469.1 Alternaria tenuissima JF802117.1 Alternaria mali JQ004404.1 Alternaria longipes JF422730.1 Alternaria porri

KC464334.1 Alternaria arborescens JX290150.1 Alternaria brassicae EU520228.1 Alternaria azukiae EU520199.1 Alternaria bokurai EU520078.1 Alternaria gaisen EU520049.1 Alternaria citri EF136372.1 Alternaria mali GQ176283.1 Alternaria destruens JF710585.1 Alternaria sesami JF710544.1 Alternaria ricini JF710542.1 Alternaria carthami FJ040178.1 Alternaria tenuis JX418351.1 Alternaria rosicola JX418348.1 Alternaria pruni JX418342.1 Alternaria napiformis JX418326.1 Alternaria atrans HM776407.1 Alternaria compacta JN543688.1 Alternaria palandui JX418338.1|Alternaria kikuchiana JX418334.1 Alternaria citrimacularis sample IMV4

sample IMV3

DQ323681.1 Alternaria destruens

(11)

Проведенное секвенирование нуклеотидной последовательности ITS-регионов ДНК штаммов грибов показало, что последовательности ДНК ITS регионов грибов рода Fusarium и Alternaria имели схожесть по родовым принадлежностям, поэтому в дальнейшем планируется установление видовой принадлежности микромицетов и определение структуры их популяции.

Таким образом, для выявления фитопатогенных организмов, необходимо использовать диагностическую систему, которая включает весь спектр фитопатологических (симптомы заболе- ваний растений), микробиологических (выделение патогена в чистую культуру, культурально- морфологические и микроскопические исследования) и молекулярно-генетических характеристик возбудителей болезней сельскохозяйственных растений.

ЛИТЕРАТУРА

[1] Санин С.С. Роль сорта в интегрированной защите зерновых культур // Защита и карантин растений. 2007. №3.

С. 16.

[2] Eyal Z. Physiologic specialization of Septoriatritici / Z. Eyal, Z. Amiri, I. Wahl // Phytopathology. 1973.Vol. 63; №9, P. 1087-1091.

[3] Kulik T. Detection of Fusariumtricinctum from cereal grain using PCR assay // Journal Appl Genet. Vol 49 (3). 2008.

Р. 305–311.

[4] Abd-Elsalam K.A., Aly I.N., Abdel-Satar M.A., Khalil M.S., Verreet J. A. PCR identification of Fusarium genus based on nuclear ribosomal-DNA sequence data // African Journal of Biotechnology. 2003. Vol. 2 (4).Р. 82-85.

[5] Арефьев В. А., Лисовенко Л. А. Англо-русский толковый словарь генетических терминов / Науч. ред. Л. И. Пат- рушев.Москва: Изд-воВНИРО, 1995.407с.

[6] Gerbi S. A. Evolution of ribosomal DNA // In: Molecular Evolutionary Genetics. N. Y.: Plenum.1985. P. 419-517.

[7] Narayanasamy P. Presentation of essential and latest information on detection of fungal plant pathogens and diagnosis of the diseases caused by them // Microbial Plant Pathogens - Detection and Disease Diagnosis: Fungal Pathogens. 2011. Vol. 1.

P. 1-4.

[8] Lievens B., Brouwer M., Vanachter A.C.R.C., Levesque C.A., Cammue B.P.A. &Thomma B.P.H.J. Quantitative assess- ment of phytopathogenic fungi in various substrates using a DNA macroarray // Environmental Microbiology. 2005. Vol.7. №11.

P. 1698-1710.

[9] Kristensen R., Torp M., Kosiak B. & Holst-Jensen A. Phylogeny and toxigenic potential is correlated in Fusarium species as revealed by partial translation elongation factor 1 alpha gene sequences // Mycological Research. 2005. Vol.109. №2.

P. 173–186.

[10] Yli-Mattila T, Paavanen S., Hannukkala A., Parikka P., Tahvonen R., Karjalainen R. Isozyme and RAPD-PCR analyses of Fusariumavenaceum strains from Finland // Plant Pathol., 1996. Vol. 45.P. 126-134.

[11] Grimm C., Geisen R. A PCR-ELISA for the detection of potential fumonisin producing Fusarium species // Letters Application of Microbiology. 1988, № l., Vol. 26.,P. 456-462.

[12] Baird R., Hamed K. Abbas, Windham G., Williams P., Baird S., Ma P., Kelley R., Hawkins L., Scruggs M. Identi- fication of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro // International Journal Molecular Sciences. 2008, № 9.,Р. 554-570.

[13] Batista J.F., Santos N.T., Oliveira A.P.D., Pires C.M.S., Motta and Luna-Alves Lima Е.А. Genetic characterization of Brazilian strains of Aspergillusflavus using DNA markers // Genetics and Molecular Research. 2008, № 7.Vol. 3.Р. 706-717.

[14] Barnes, C.W. &Szabo, L.J. (2007). Detection and identification of four common rust pathogens of cereals and grasses using real-time polymerase chain reaction // Phytopathology. 2007.Vol.97. No.6.P. 717-727.

[15] Егоров Н.С. Руководство к практическим занятиям по микробиологии. Московский Университет. 1983. С. 220.

[16] Емцев В.Т.,Мишустин Е.Н. Микробиология. Москва. 2005. С. 444.

[17] Саттон Д., Фотергилл А., Ринальди М. Определитель патогенных и условно-патогенных грибов. М.: Мир. 2001.

С. 3-5.

[18] WhiteT.J. AmplificationanddirectsequencingoffungalribosomalDNAgenesforphylogenetics / T.J. White, T. Bruns, S.B.

Lee, J.W- Taylor // PCRProtocolaGuidetoMethodsandApplications. AcademicPress. 1990.N.Y. P.315-322.

[19] Ллуэлин М.Б. Определение нуклеотидной последовательности ДНК. Молекулярная клиническая диагностика.

Методы. М.: Мир, 1999. С. 428 - 447.

[20] FredlundЕ.,GidlundА., Olsen М., BörjessonТ., HytteSpliid H.N., Simonsson M. Method evaluation of Fusarium DNA extraction from mycelia and wheat for down-stream real-time PCR quantification and correlation to mycotoxin levels // Journal of Microbiological Methods. 2008, №73.Р. 33–40.

REFERENCES

[1] Sanin S.S. Role of species in integrated management of cereals // Plant Protection and Quarantine. 2007. №3. p. 16. (in Russ.).

[2] Eyal Z. Physiologic specialization of Septoriatritici /Z. Eyal, Z. Amiri, I. Wahl // Phytopathology. 1973.V. 63; №9, P. 1087-1091.

[3] Kulik T. Detection of Fusariumtricinctum from cereal grain using PCR assay // Journal Appl Genet.Vol 49 (3). 2008.

Р. 305–311.

(12)

[4] Abd-Elsalam K.A., Aly I.N., Abdel-Satar M.A., Khalil M.S., Verreet J. A. PCR identification of Fusarium genus based on nuclear ribosomal-DNA sequence data // African Journal of Biotechnology. 2003. Vol. 2 (4). Р. 82-85.

[5] Aref'ev V.A., Lisovenko L. A. English-Russian Dictionary of Genetic Terms.Ed. L.I. Patrushev. Moskva: Izd-vo VNIRO, 1995. 407p.

[6] Gerbi S.A. Evolution of ribosomal DNA // In: Molecular Evolutionary Genetics. N. Y.: Plenum.1985. P. 419-517.

[7] Narayanasamy P. Presentation of essential and latest information on detection of fungal plant pathogens and diagnosis of the diseases caused by them // Microbial Plant Pathogens - Detection and Disease Diagnosis: Fungal Pathogens. 2011. Vol. 1. P. 1-4.

[8] Lievens B., Brouwer M., Vanachter A.C.R.C., Levesque C.A., Cammue B.P.A. &Thomma B.P.H.J. Quantitative assessment of phytopathogenic fungi in various substrates using a DNA macroarray // Environmental Microbiology. 2005. Vol.7.

№11. P. 1698-1710.

[9] Kristensen R., Torp M., Kosiak B. & Holst-Jensen A. Phylogeny and toxigenic potential is correlated in Fusarium species as revealed by partial translation elongation factor 1 alpha gene sequences // Mycological Research. 2005. Vol.109. №2.

P. 173–186.

[10] Yli-Mattila T, Paavanen S., Hannukkala A., Parikka P., Tahvonen R., Karjalainen R. Isozyme and RAPD-PCR ana- lyses of Fusariumavenaceum strains from Finland // Plant Pathol., 1996. Vol. 45.P. 126-134.

[11] Grimm C., Geisen R. A PCR-ELISA for the detection of potential fumonisin producing Fusarium species // Letters Application of Microbiology. 1988, № l. Vol. 26. P. 456-462.

[12] Baird R., Hamed K. Abbas, Windham G., Williams P., Baird S., Ma P., Kelley R., Hawkins L., Scruggs M. Identifi- cation of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relation- ship to Fumonisin Production in vitro // International Journal Molecular Sciences. 2008, №9.Р. 554-570.

[13] Batista J.F., Santos N.T., Oliveira A.P.D., Pires C.M.S., Motta and Luna-Alves Lima Е.А. Genetic characterization of Brazilian strains of Aspergillusflavus using DNA markers // Genetics and Molecular Research. 2008, № 7.Vol. 3.Р. 706-717.

[14] Barnes, C.W. &Szabo, L.J. (2007). Detection and identification of four common rust pathogens of cereals and grasses using real-time polymerase chain reaction // Phytopathology. – 2007.Vol.97. No.6.P. 717-727.

[15] Egorov N.S. Guide to practical training in microbiology. Moscow University. 1983. p. 220. (in Russ.).

[16] Emcev V.T., Mishustin E.N. Microbiology. Moskva. 2005. p. 444. (in Russ.).

[17] Satton D., Fotergill A., Rinal'di M. The determinant of pathogenic and opportunistic fungi. M.: Mir. 2001. p. 3-5. (in Russ.).

[18] White T.J. Amplification and direct sequencing of fungal ribosomal DNA genes for phylogenetics / T.J. White, T. Bruns, S.B. Lee, J.W- Taylor // PCR Protocol a Guide to Methods and Applications.AcademicPress. 1990. N.Y. P.315-322.

[19] Llujelin M.B. Determination of nucleotide sequence of DNA.Molecular Clinical Diagnostics.Metody. M.: Mir, 1999.

p. 428 - 447.(in Russ.).

[20] FredlundЕ.,GidlundА., Olsen М., BörjessonТ., HytteSpliid H.N., Simonsson M. Method evaluation of Fusarium DNA extraction from mycelia and wheat for down-stream real-time PCR quantification and correlation to mycotoxin levels // Journal of Microbiological Methods. 2008,№73. Р. 33–40.

АЛМАТЫ ОБЛЫСЫНДА ӨСЕТІН ҚЫТАЙБҰРШАҚ ӨСІМДІГІН ЗАҚЫМДАЙТЫН ФИТОПАТОГЕНДІ САҢЫРАУҚҰЛАҚТАРДЫҢ МИКРОБИОЛОГИЯЛЫҚ

ЖƏНЕ МОЛЕКУЛЯРЛЫҚ-ГЕНЕТИКАЛЫҚ СИПАТТАМАСЫ А. И. Сейітбатталова, С. Т. Дауғалиева, О. Н. Шемшура, Э. Т. Ысмайылова ҚР БҒМ ҒК «Микробиология жəне вирусология институты» РМК, Алматы, Қазақстан

Тірек сөздер: фитопатогенді саңырауқұлақтар, Fusarium, Alternaria, морфологиялық-микроскопиялық сипаттама, ДНҚ-ның ITS-аумақтары, праймерлер, секвенирлеу.

Зерттеулер нəтижесінде Алматы облысында өсетін қытайбұршақ өсімдігін зақымдайтын фитопатогенді саңырауқұлақтардың морфологиялық ерекшілктері бойынша, олардың қандай туысына жататыны анық- талды.

СТАВ-əдісі арқылы Fusarium, Alternaria саңырауқұлақтарынан жасушалық ДНҚ бөлініп алынды. ПТР реакциясы ITS 5 5’ – ggaagtaaaagtcgtaacaagg-3’ жəне ITS 4 5’- tcctccgcttattgatatgc -3’ праймерлермен жүр- гізілді. GenBank генетикалық мəліметтер ашық базасында (http://www.ncbi.nlm.nih.gov) биоинформатикалық жəне гомологиялық нуклеотидтік тізбекшесін іздеу жүргізілді.

Саңырауқұлақтарды сиквенерлеу нəтижесінде Fusarium жəне Alternariaсаңырауқұлақтардың түріне жатататыны анықталды. Бөлініп алынған саңырауқұлақтардың GenBank мəліметтер базасында нуклеотидтік тізбектерін салыстырғанда 100% ұқсастығын көрсетті. ДНҚ-ның ITS-аумақтарының тізбектерін салыстыру

негізделген, филогенетикалық талдауға сəйкес Fusarium sp. штамдары жеке кластерге топталды, олар F. incarnatum, F. equiseti, F. chlamidosporumжəнеF. campocerasсаңырауқұлақтарымен ұқсас,сонымен қатар

Alternaria sp. саңрауқұлақтарыА. alternata, A. tenuissima, A. compacta, A. Porri-мен ұқсас болды.

Поступила 31.07.2015 г.

(13)

Publication Ethics and Publication Malpractice

in the journals of the National Academy of Sciences of the Republic of Kazakhstan

For information on Ethics in publishing and Ethical guidelines for journal publication see http://www.elsevier.com/publishingethics and http://www.elsevier.com/journal-authors/ethics.

Submission of an article to the National Academy of Sciences of the Republic of Kazakhstan implies that the described work has not been published previously (except in the form of an abstract or as part of a published lecture or academic thesis or as an electronic preprint, see http://www.elsevier.com/postingpolicy), that it is not under consideration for publication elsewhere, that its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and that, if accepted, it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder. In particular, translations into English of papers already published in another language are not accepted.

No other forms of scientific misconduct are allowed, such as plagiarism, falsification, fraudulent data, incorrect interpretation of other works, incorrect citations, etc. The National Academy of Sciences of the Republic of Kazakhstan follows the Code of Conduct of the Committee on Publication Ethics (COPE), and follows the COPE Flowcharts for Resolving Cases of Suspected Misconduct (http://publicationethics.org/files/u2/New_Code.pdf). To verify originality, your article may be checked by the Cross Check originality detection service http://www.elsevier.com/editors/plagdetect.

The authors are obliged to participate in peer review process and be ready to provide corrections, clarifications, retractions and apologies when needed. All authors of a paper should have significantly contributed to the research.

The reviewers should provide objective judgments and should point out relevant published works which are not yet cited. Reviewed articles should be treated confidentially. The reviewers will be chosen in such a way that there is no conflict of interests with respect to the research, the authors and/or the research funders.

The editors have complete responsibility and authority to reject or accept a paper, and they will only accept a paper when reasonably certain. They will preserve anonymity of reviewers and promote publication of corrections, clarifications, retractions and apologies when needed. The acceptance of a paper automatically implies the copyright transfer to the National Academy of Sciences of the Republic of Kazakhstan.

The Editorial Board of the National Academy of Sciences of the Republic of Kazakhstan will monitor and safeguard publishing ethics.

Правила оформления статьи для публикации в журнале смотреть на сайте:

www:nauka-nanrk.kz

http://www.biological-medical.kz/index.php/ru/

Редактор М. С. Ахметова

Верстка на компьютере Д. Н. Калкабековой Подписано в печать 04.07.2015.

Формат 60х881/8. Бумага офсетная. Печать – ризограф.

10,0 п.л. Тираж 300. Заказ 4.

Национальная академия наук РК

050010, Алматы, ул. Шевченко, 28, т. 272-13-18, 272-13-19

Ақпарат көздері

СӘЙКЕС КЕЛЕТІН ҚҰЖАТТАР

У 70% обнаруженных цветущих растений, наблюдались существенные сдвиги в фенологии цветения, а у некоторых видов отмечалось и повторное

The purpose of the study is to analyze the current state of milk and dairy production, based on which the tasks are: monitoring the number of dairy cows by category of farms,

An author who wishes to publish an article in a journal must submit the article in hard copy (printed version) in one copy, signed by the author to the scientific publication office

Одной из важных отличительных особенностей высокотехнологичного сектора экономики является повышенный уровень добавленной стоимости, которая

Товарная структура внешней торговли отражает изменения в развитии производ- ственных процессов и конечного потребления населения и

Reengineering of business processes of a company is one of the tools to improve the efficiency of management systems of oil companies, their financial and

инфицированные грибом рода Fusarium sp., е) семена сорта гороха «Орегон» инфицированные грибом рода Botrytis sp. Сорта нута «Луч» и «Икарда» поражались грибами

KX355190.1 Alternaria alternata strain LPS-24 18S ribosomal RNA gene partial sequence internal transcribed spacer 1 5.8S ribosomal RNA gene and internal transcribed spacer 2